Universal Primer ITS5
Cat.No:PC2475 Solarbio
Storage:Store at -20℃,1 year.
Qty:
Size:
{{cart_num}}
My CartStorage:Store at -20℃,1 year.
Qty:
Size:
Name | Universal Primer ITS5 |
Storage | Store at -20℃,1 year. |
Unit | Piece |
Specification | 250ul |
Universal primers
Sequence (5'-3') : GGAAGTAAAAGTCGTAACAAGG
Concentration: 10μM
Solvent: ddH2O
Tm Value: 53.95
Application: Primers are used to identify fungal ITS. ITS(Internal Transcribed Spacer) identification is a method that performs DNA sequencing of ITS sequences and compares the sequence with the ITS sequence of known fungi to obtain information about the species of the fungus to be measured.
Note:Product information may be optimized and upgraded. Please refer to the actual label information for accuracy.
Remark:These protocols are for reference only. Solarbio does not independently validate these methods.
Note:
1. The products are all for scientific research use only. Do not use it for medical, clinical diagnosis or treatment, food and cosmetics, etc. Do not store them in ordinary residential areas.
2. For your safety and health, please wear laboratory clothes, disposable gloves and masks.
3. The experimental results may be affected by many factors, after-sale service is limited to the product itself and does not involve other compensation.
Sorry, there is no experimental images.
Sorry, there is no more information.
Sorry, there is no more information.