Universal Primer T3
Cat.No:PC2420 Solarbio
Storage:Store at -20℃,1 year.
Qty:
Size:
{{cart_num}}
My CartStorage:Store at -20℃,1 year.
Qty:
Size:
Name | Universal Primer T3 |
Storage | Store at -20℃,1 year. |
Unit | Piece |
Specification | 250ul(10uM) |
Universal primers for molecular biology experiments.
Sequence (5'-3') : ATTAACCCTCACTAAAGGGA
Concentration: 10μM
Solvent: ddH2O
Tm value: 51.3
Application: A universal primer for T3 primer site sequencing, suitable for sequencing DNA fragments cloned in M13 series, pUC series and other vectors.
Note:Product information may be optimized and upgraded. Please refer to the actual label information for accuracy.
Remark:These protocols are for reference only. Solarbio does not independently validate these methods.
Note:
1. The products are all for scientific research use only. Do not use it for medical, clinical diagnosis or treatment, food and cosmetics, etc. Do not store them in ordinary residential areas.
2. For your safety and health, please wear laboratory clothes, disposable gloves and masks.
3. The experimental results may be affected by many factors, after-sale service is limited to the product itself and does not involve other compensation.
Sorry, there is no experimental images.
Sorry, there is no more information.
Sorry, there is no more information.